ID: 1013298902_1013298903

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1013298902 1013298903
Species Human (GRCh38) Human (GRCh38)
Location 6:108784600-108784622 6:108784637-108784659
Sequence CCATTCTCATCAACTTTTGGTAT CAAGAAATTCCCACTCTAATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 425} {0: 1, 1: 0, 2: 2, 3: 16, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!