ID: 1013315655_1013315660 |
View in Genome Browser |
Spacer: 16 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1013315655 | 1013315660 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 6:108940238-108940260 | 6:108940277-108940299 |
| Sequence | CCTGGGTGACAGAGGAAGACTCT | ACATGGACACACATGGAGTGAGG |
| Strand | - | + |
| Off-target summary | No data | {0: 3, 1: 8, 2: 28, 3: 77, 4: 333} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||