|
Left Crispr |
Right Crispr |
| Crispr ID |
1013315683 |
1013315686 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:108940445-108940467
|
6:108940468-108940490
|
| Sequence |
CCAAAGATTGGTTGGACCAGGTG |
TGATGTTTACATAGCACGCAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 51, 1: 84, 2: 63, 3: 69, 4: 117} |
{0: 1, 1: 9, 2: 25, 3: 49, 4: 145} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|