ID: 1013336717_1013336721

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1013336717 1013336721
Species Human (GRCh38) Human (GRCh38)
Location 6:109170846-109170868 6:109170868-109170890
Sequence CCTTCATTTTCCCTGAAATGAAC CCAAGCTACCAATTTAAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 331} {0: 1, 1: 0, 2: 0, 3: 1, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!