ID: 1013366371_1013366382

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1013366371 1013366382
Species Human (GRCh38) Human (GRCh38)
Location 6:109440973-109440995 6:109441014-109441036
Sequence CCTGAGCCACGCGGGCTTGGTGC TGCGAAGAAGGAACGGTCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 97} {0: 1, 1: 0, 2: 0, 3: 4, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!