ID: 1013384788_1013384792

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1013384788 1013384792
Species Human (GRCh38) Human (GRCh38)
Location 6:109615862-109615884 6:109615879-109615901
Sequence CCGCTCAACTATAAACCAGTCAC AGTCACACCTAAGAATGTAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 100} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!