ID: 1013406668_1013406674

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1013406668 1013406674
Species Human (GRCh38) Human (GRCh38)
Location 6:109849774-109849796 6:109849819-109849841
Sequence CCTGCCATCTTCTACAGATAACT CTTGGCCAGTTACTGGGCTTTGG
Strand - +
Off-target summary No data {0: 2, 1: 176, 2: 172, 3: 115, 4: 236}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!