ID: 1013428511_1013428518

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1013428511 1013428518
Species Human (GRCh38) Human (GRCh38)
Location 6:110035743-110035765 6:110035783-110035805
Sequence CCTGTTATTCCAACACTGTGGGA CACTTGAGCCTAGAAGTTGGAGG
Strand - +
Off-target summary {0: 1, 1: 39, 2: 1800, 3: 41902, 4: 347425} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!