ID: 1013431009_1013431024

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1013431009 1013431024
Species Human (GRCh38) Human (GRCh38)
Location 6:110054849-110054871 6:110054901-110054923
Sequence CCCAGATGCCCCAGACAGAGTGT GAACCCCAGGGGCCATCAGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 10, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!