ID: 1013438710_1013438722

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1013438710 1013438722
Species Human (GRCh38) Human (GRCh38)
Location 6:110139382-110139404 6:110139422-110139444
Sequence CCCAGCCCTGACCGCTCCTCCCC TTGCAGCAGCTGCTACATACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 68, 4: 664} {0: 1, 1: 0, 2: 10, 3: 33, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!