ID: 1013442159_1013442160

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1013442159 1013442160
Species Human (GRCh38) Human (GRCh38)
Location 6:110181179-110181201 6:110181218-110181240
Sequence CCAACTAGTGAGAGTGCAGTAAA GTGTTAATACAGTGAGAAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 84} {0: 1, 1: 0, 2: 2, 3: 27, 4: 391}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!