ID: 1013468216_1013468220

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1013468216 1013468220
Species Human (GRCh38) Human (GRCh38)
Location 6:110436252-110436274 6:110436275-110436297
Sequence CCCTGATAGTGCTGGTGGCACCA AGAATTTCCCCACTCCTTCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 19, 4: 316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!