ID: 1013472384_1013472395

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1013472384 1013472395
Species Human (GRCh38) Human (GRCh38)
Location 6:110476734-110476756 6:110476770-110476792
Sequence CCCCTCGGTCCCCCCAAGTATCT TGCCGCCTCGGCCTCCTTCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 112} {0: 1, 1: 0, 2: 2, 3: 55, 4: 424}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!