ID: 1013472392_1013472404

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1013472392 1013472404
Species Human (GRCh38) Human (GRCh38)
Location 6:110476747-110476769 6:110476795-110476817
Sequence CCAAGTATCTTCGGCTTTTTTCC CGCTGTGGTCCCGGCGCCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 118} {0: 1, 1: 0, 2: 1, 3: 14, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!