ID: 1013472394_1013472404

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1013472394 1013472404
Species Human (GRCh38) Human (GRCh38)
Location 6:110476768-110476790 6:110476795-110476817
Sequence CCTGCCGCCTCGGCCTCCTTCCC CGCTGTGGTCCCGGCGCCCGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 121, 4: 1076} {0: 1, 1: 0, 2: 1, 3: 14, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!