ID: 1013475807_1013475814

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1013475807 1013475814
Species Human (GRCh38) Human (GRCh38)
Location 6:110506308-110506330 6:110506330-110506352
Sequence CCTCCTTCCTCCATCTCTGTTTC CCAGCAGGGAGCTGACCATGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 15, 3: 205, 4: 1473} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!