ID: 1013490814_1013490820

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1013490814 1013490820
Species Human (GRCh38) Human (GRCh38)
Location 6:110644750-110644772 6:110644770-110644792
Sequence CCCTCCTTCCTCTGGTGTTTTAG TAGAACTACAGAGGAGGTGAAGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 2, 3: 32, 4: 340} {0: 1, 1: 0, 2: 0, 3: 23, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!