ID: 1013491535_1013491543

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1013491535 1013491543
Species Human (GRCh38) Human (GRCh38)
Location 6:110651071-110651093 6:110651087-110651109
Sequence CCGGAAATCAAGAGCTCAGGCAA CAGGCAAAGGGTTGGGAAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 44, 4: 332} {0: 1, 1: 0, 2: 7, 3: 60, 4: 596}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!