|
Left Crispr |
Right Crispr |
| Crispr ID |
1013504738 |
1013504743 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:110788268-110788290
|
6:110788284-110788306
|
| Sequence |
CCCTCCTGCCTCAGCTTCTCAAA |
TCTCAAATATCTAGGACTACAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 49, 2: 494, 3: 2067, 4: 5235} |
{0: 2, 1: 30, 2: 671, 3: 9398, 4: 75525} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|