ID: 1013504738_1013504743

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1013504738 1013504743
Species Human (GRCh38) Human (GRCh38)
Location 6:110788268-110788290 6:110788284-110788306
Sequence CCCTCCTGCCTCAGCTTCTCAAA TCTCAAATATCTAGGACTACAGG
Strand - +
Off-target summary {0: 3, 1: 49, 2: 494, 3: 2067, 4: 5235} {0: 2, 1: 30, 2: 671, 3: 9398, 4: 75525}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!