ID: 1013509489_1013509495 |
View in Genome Browser |
Spacer: -8 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1013509489 | 1013509495 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 6:110831536-110831558 | 6:110831551-110831573 |
| Sequence | CCTCCCACTTTCACCTTCCGAAG | TTCCGAAGTGCCGGGATTATAGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 51, 2: 2441, 3: 49547, 4: 346956} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||