|
Left Crispr |
Right Crispr |
| Crispr ID |
1013530680 |
1013530694 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:111017174-111017196
|
6:111017210-111017232
|
| Sequence |
CCCGTTCTCAATGAGCTGTTGGG |
CGGGGTGGCGGCCGGGTAGAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1398, 1: 571, 2: 139, 3: 41, 4: 130} |
{0: 2, 1: 205, 2: 1212, 3: 1143, 4: 1642} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|