ID: 1013530682_1013530694

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1013530682 1013530694
Species Human (GRCh38) Human (GRCh38)
Location 6:111017175-111017197 6:111017210-111017232
Sequence CCGTTCTCAATGAGCTGTTGGGT CGGGGTGGCGGCCGGGTAGAGGG
Strand - +
Off-target summary No data {0: 2, 1: 205, 2: 1212, 3: 1143, 4: 1642}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!