|
Left Crispr |
Right Crispr |
| Crispr ID |
1013530943 |
1013530951 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:111018170-111018192
|
6:111018185-111018207
|
| Sequence |
CCAGCTTCGGCTCGGCATCAGGG |
CATCAGGGGGAGACCGGGGAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 4, 1: 455, 2: 574, 3: 447, 4: 269} |
{0: 1, 1: 2, 2: 90, 3: 28, 4: 218} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|