ID: 1013548600_1013548601

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1013548600 1013548601
Species Human (GRCh38) Human (GRCh38)
Location 6:111184889-111184911 6:111184912-111184934
Sequence CCAAGGGTCAATCAACACTGGAA TGTAGCTATTAGACCTTGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 162} {0: 1, 1: 0, 2: 2, 3: 9, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!