ID: 1013558009_1013558012

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1013558009 1013558012
Species Human (GRCh38) Human (GRCh38)
Location 6:111276871-111276893 6:111276896-111276918
Sequence CCAGAGGAAACCTGTTTGACTTG TAGATGCCATTGCCCTTATTGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 14, 4: 148} {0: 2, 1: 0, 2: 2, 3: 5, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!