ID: 1013558024_1013558030

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1013558024 1013558030
Species Human (GRCh38) Human (GRCh38)
Location 6:111276960-111276982 6:111276997-111277019
Sequence CCGGAGGAAACCTGTTTGACTTG CCCTTATTGGGCCTTGCCTCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 14, 4: 148} {0: 2, 1: 0, 2: 0, 3: 4, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!