ID: 1013568130_1013568135

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1013568130 1013568135
Species Human (GRCh38) Human (GRCh38)
Location 6:111390647-111390669 6:111390660-111390682
Sequence CCATTCTTCCTGCCCTCAACTAC CCTCAACTACTGCTGAGATAGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 2, 3: 33, 4: 440} {0: 1, 1: 0, 2: 0, 3: 8, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!