ID: 1013607591_1013607603

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1013607591 1013607603
Species Human (GRCh38) Human (GRCh38)
Location 6:111764871-111764893 6:111764920-111764942
Sequence CCTTCCCTGCTGTGGCTCATTCT GAGGCAGGAGGGTGCTCTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 106, 4: 643} {0: 1, 1: 0, 2: 6, 3: 58, 4: 577}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!