ID: 1013609745_1013609750

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1013609745 1013609750
Species Human (GRCh38) Human (GRCh38)
Location 6:111783330-111783352 6:111783356-111783378
Sequence CCCCAATAACCATGACTGATGAG TCCACTCACAGAACAAAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 87} {0: 1, 1: 0, 2: 2, 3: 19, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!