ID: 1013675984_1013675993

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1013675984 1013675993
Species Human (GRCh38) Human (GRCh38)
Location 6:112463750-112463772 6:112463793-112463815
Sequence CCAAATCTCACCTTGAATTGTAG CATGAGAGGGACCCAGTGGAAGG
Strand - +
Off-target summary {0: 250, 1: 5448, 2: 9006, 3: 8554, 4: 8035} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!