ID: 1013694123_1013694135

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1013694123 1013694135
Species Human (GRCh38) Human (GRCh38)
Location 6:112681290-112681312 6:112681341-112681363
Sequence CCTTCCTTCTCTGCCCTTGTTAG CATCCCACTGGCTTTTGGCTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!