ID: 1013808456_1013808463

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1013808456 1013808463
Species Human (GRCh38) Human (GRCh38)
Location 6:114018291-114018313 6:114018322-114018344
Sequence CCTGTCTCTTCTCATTCCTTTGT GACTTCGGGTACCCTACGAGTGG
Strand - +
Off-target summary {0: 23, 1: 18, 2: 19, 3: 67, 4: 652} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!