ID: 1013814585_1013814588

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1013814585 1013814588
Species Human (GRCh38) Human (GRCh38)
Location 6:114082922-114082944 6:114082945-114082967
Sequence CCACATGTGTCAGGGATAAGAAC CCCTTCCCCTCCCTTGTCCAAGG
Strand - +
Off-target summary {0: 11, 1: 31, 2: 69, 3: 105, 4: 307} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!