ID: 1013815752_1013815759

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1013815752 1013815759
Species Human (GRCh38) Human (GRCh38)
Location 6:114095410-114095432 6:114095445-114095467
Sequence CCCATGCCTTTCTTCAGGGCTGA GCTCACATGAATATGGGAGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 31, 4: 491}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!