ID: 1013836703_1013836705

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1013836703 1013836705
Species Human (GRCh38) Human (GRCh38)
Location 6:114342821-114342843 6:114342835-114342857
Sequence CCGGTGCCAAGCTGTGCGGGCGC TGCGGGCGCCCCGCTCCCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 2, 4: 88} {0: 1, 1: 0, 2: 1, 3: 15, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!