ID: 1013858203_1013858212

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1013858203 1013858212
Species Human (GRCh38) Human (GRCh38)
Location 6:114601540-114601562 6:114601588-114601610
Sequence CCCTCTGCTAGCTGCTATGCTAG CAAGGTAAATTGAGGGAGGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 14, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!