ID: 1013931151_1013931162

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1013931151 1013931162
Species Human (GRCh38) Human (GRCh38)
Location 6:115534601-115534623 6:115534650-115534672
Sequence CCTTGGCCTCCCAAAGTGCTGGG GCCATTGTTAAGTTTAAAGAGGG
Strand - +
Off-target summary {0: 79234, 1: 201556, 2: 232767, 3: 156913, 4: 93134} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!