ID: 1013946165_1013946168

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1013946165 1013946168
Species Human (GRCh38) Human (GRCh38)
Location 6:115725254-115725276 6:115725281-115725303
Sequence CCTGTTATTGGTCTGCTCAGAGC GTTTCTTCCTGGTTTAATCTAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 157, 3: 6177, 4: 3129} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!