ID: 1013946167_1013946172

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1013946167 1013946172
Species Human (GRCh38) Human (GRCh38)
Location 6:115725276-115725298 6:115725300-115725322
Sequence CCTCTGTTTCTTCCTGGTTTAAT TAGGAGGGTTGTATATTTCCAGG
Strand - +
Off-target summary No data {0: 161, 1: 558, 2: 595, 3: 439, 4: 656}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!