ID: 1013992035_1013992042

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1013992035 1013992042
Species Human (GRCh38) Human (GRCh38)
Location 6:116265136-116265158 6:116265155-116265177
Sequence CCACAGTGGCAGAGGAAATGCAG GCAGCTGCAGGGGTGGGGAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 23, 3: 229, 4: 1509}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!