ID: 1013995666_1013995670

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1013995666 1013995670
Species Human (GRCh38) Human (GRCh38)
Location 6:116304775-116304797 6:116304806-116304828
Sequence CCAGCCCTCATCTGCCTAGAATG CTACCCCTTGCCTTTTCCTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 78, 4: 333} {0: 1, 1: 0, 2: 1, 3: 22, 4: 280}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!