ID: 1014002306_1014002315

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1014002306 1014002315
Species Human (GRCh38) Human (GRCh38)
Location 6:116378130-116378152 6:116378181-116378203
Sequence CCATCTTCCCTGAAGAAAAGAAG GAAGGATTTATGGTAAATACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 68, 4: 479} {0: 1, 1: 0, 2: 1, 3: 11, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!