ID: 1014007964_1014007979

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1014007964 1014007979
Species Human (GRCh38) Human (GRCh38)
Location 6:116442934-116442956 6:116442959-116442981
Sequence CCATATTCCATATGTTTACTCCC GGGTGAGGTGGGGCAGGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 180} {0: 2, 1: 8, 2: 45, 3: 465, 4: 3926}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!