ID: 1014007964_1014007980

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1014007964 1014007980
Species Human (GRCh38) Human (GRCh38)
Location 6:116442934-116442956 6:116442960-116442982
Sequence CCATATTCCATATGTTTACTCCC GGTGAGGTGGGGCAGGGAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 180} {0: 2, 1: 4, 2: 46, 3: 394, 4: 2833}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!