ID: 1014012775_1014012778

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1014012775 1014012778
Species Human (GRCh38) Human (GRCh38)
Location 6:116495317-116495339 6:116495338-116495360
Sequence CCATCCATGTTTTGCAAATGACA CAGGATCTCATTCTTCTTTATGG
Strand - +
Off-target summary {0: 2, 1: 14, 2: 23, 3: 76, 4: 360} {0: 17, 1: 377, 2: 2008, 3: 6355, 4: 15136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!