ID: 1014094518_1014094526

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1014094518 1014094526
Species Human (GRCh38) Human (GRCh38)
Location 6:117445648-117445670 6:117445686-117445708
Sequence CCCTCTCCCTCTCTGACCTTCTT CCAACCAGCCAGACTCCTTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 18, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!