|
Left Crispr |
Right Crispr |
| Crispr ID |
1014162939 |
1014162944 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:118191047-118191069
|
6:118191088-118191110
|
| Sequence |
CCTCTTTTATTCCAAACCATGGA |
ATGCCCTTCTAGAAGAGTAAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 8, 1: 29, 2: 32, 3: 52, 4: 208} |
{0: 3, 1: 14, 2: 52, 3: 55, 4: 144} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|