ID: 1014162941_1014162944 |
View in Genome Browser |
Spacer: 7 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1014162941 | 1014162944 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 6:118191058-118191080 | 6:118191088-118191110 |
| Sequence | CCAAACCATGGAAAAAGGACCTA | ATGCCCTTCTAGAAGAGTAAAGG |
| Strand | - | + |
| Off-target summary | No data | {0: 3, 1: 14, 2: 52, 3: 55, 4: 144} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||