ID: 1014162941_1014162944

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1014162941 1014162944
Species Human (GRCh38) Human (GRCh38)
Location 6:118191058-118191080 6:118191088-118191110
Sequence CCAAACCATGGAAAAAGGACCTA ATGCCCTTCTAGAAGAGTAAAGG
Strand - +
Off-target summary {0: 14, 1: 15, 2: 18, 3: 7, 4: 111} {0: 3, 1: 14, 2: 52, 3: 55, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!