ID: 1014170916_1014170917

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1014170916 1014170917
Species Human (GRCh38) Human (GRCh38)
Location 6:118278231-118278253 6:118278245-118278267
Sequence CCTCAGAAGGTGTCTCCACAGTG TCCACAGTGAGCACAGAACGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 16, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!