ID: 1014190601_1014190604

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1014190601 1014190604
Species Human (GRCh38) Human (GRCh38)
Location 6:118491996-118492018 6:118492040-118492062
Sequence CCAGCTATCTTGCTTCCTAGTTA TACTTACCTTCTCAAAACCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 15, 4: 143} {0: 1, 1: 0, 2: 0, 3: 19, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!